Channel

Nurgle's Cauldron

@nurglescauldron

On this record: Growth · Engagement · Reactions · Posts · Citations · Cite this entry

146subscribers

-1 since we began measuring on 7 August 2026

Risers and fallers across the register · movement among entries of Under 1,000.

Register entry

Telegram ID	-1001728662519
Type	Channel
Username	@nurglescauldron
Created	Between 1 December 2021 and 30 April 2023 — estimated from Telegram’s id allocation, not measured. How this range is calculated.
First recorded	8 August 2026
Last confirmed live	8 September 2026
Measurements held	3
Confirmed unchanged	1 time, most recently 8 September 2026
On Telegram	t.me/nurglescauldron

Growth

3 measurements spanning 32 days, net -1. Dots are measurements; the straight line between them is drawn to join them, not to claim we know the path taken in between — snapshots are recorded only when a count changes, so gaps mean “no change observed”, never “interpolated”. The vertical axis spans 146–147 and does not start at zero.

Measurement log — every subscribers count we have recorded
Measured (UTC)	Subscribers	Change
8 Sept 2026, 15:15	146	-1
8 Aug 2026, 20:45	147	no change
7 Aug 2026, 18:23	147	first reading

Engagement

17 posts held, back to 23 November 2024 — the reader has not yet reached the start of this channel’s public history, so older posts may sit further back, unread. Read across 1 page of Telegram’s post history, 20 posts per page.

Nothing published in the last 30 days. ERR and ER are rolling 30-day measures, so there is nothing to compute — we hold 17 posts for this entry, the most recent from 20 May 2026. An engagement rate over an empty window would be a number about nothing.

Reaction mix

91 reactions across 12 posts, in 5 distinct kinds. The most used accounts for 36.3% of them.

Every reaction kind recorded on the sample, most used first
Reaction	Count	Share
👍	33	36.3%
❤	23	25.3%
🔥	18	19.8%
🎉	14	15.4%
🤩	3	3.30%

No sentiment is inferred, and none should be read in. This table is ordered by count and by nothing else. Emoji do not carry stable meaning across languages or communities — 🙏 is thanks in one channel and mourning in another — so we publish which ones were pressed and how often, and pass no judgement on what an audience meant by them.

Precision. Telegram publishes reaction counts per emoji and short-forms each one — 4.34K, 1.2M — so any single kind at or above 1,000 reaches us at three significant figures, and only counts below 1,000 are exact. The shares above are ratios of those figures and carry the same error. This is also why the total here can differ slightly from a reaction total printed elsewhere on the page: both are sums of the same rounded parts, taken over samples with different edges.

Coverage. Reactions were read on 13 of the 17 sampled posts in this sample. Summed by Telegram’s own count on each post — not by adding up the per-emoji breakdown above — those same posts carry 91 reactions in total: the kind of figure the paragraph above means by “a reaction total printed elsewhere on the page”.

Measured over the 17 most recent posts we hold, published 23 November 2024 to 20 May 2026, using the newest reading held for each. Telegram Stars are excluded: they are a payment, not a reaction, and they have their own section.

Recent posts

20 May 2026, 06:01 UTC≈1,280 views3 reactionsread 8 August 2026

Photo

FragalyseQt - 0.5.3 Что это такое: свободный (AGPLv3) и кроссплатформенный (Linux, macOS, *BSD, Windows - x86, ARM, RISC-V...) софт для неинвазивного (исходные файлы НЕ ИЗМЕНЯЮТСЯ) анализа данных капиллярного электрофореза, способный обрабатывать результаты, независимо от оборудования, на котором они было получены (поддерживаются в т.ч. древние и недокументированные версии ABIF), а также корректировать базовую лини…

🔥3

Signed Father Nurgle

11 May 2026, 17:53 UTC≈2,510 views4 reactionsread 8 August 2026

Photo

Новый релиз FragalyseQt - 0.5.2 Что это такое: свободный (AGPLv3) и кроссплатформенный (Linux, macOS, *BSD, Windows - x86, ARM, RISC-V, работает всё) софт для неинзвазивного (исходные файлы НЕ ИЗМЕНЯЮТСЯ) анализа данных капиллярного электрофореза, способный обрабатывать результаты, независимо от того, на каком оборудовании они было получены (поддерживаются даже древние и недокументированные версии ABIF), а также ко…

👍4

Signed Father Nurgle

30 Apr 2026, 15:30 UTC154 views3 reactionsread 8 August 2026

Photo

New release of FragalyseQt - 0.5.1 What#s this: free (AGPLv3)and crossplatform (Linux, macOS, *BSD, Windows, x86, ARM, RISC-V - proven to work) soft for non-invasive capillary electrophoresis data analysis, capable f handling CE data inependently from machine they were obtained at (even extremely old and undocumented versions of ABIF are supported), corresct baseline, denoise signal, sizecall fragments, bin alleles…

🔥2👍1

Signed Father Nurgle

30 Apr 2026, 12:19 UTC≈1,070 viewsread 8 August 2026

Photo

Photo, posted without a caption

Signed Father Nurgle

30 Apr 2026, 12:19 UTC≈1,220 views1 reactionsread 8 August 2026

File

Новый релиз FragalyseQt - 0.5.1 Что это такое: свободный (AGPLv3) и кроссплатформенный (Linux, macOS, *BSD, Windows - проверяли, работает) софт для неизвазивного (исходные файлы НЕ ИЗМЕНЯЮТСЯ) анализа данных капиллярного электрофореза, способный обрабатывать результаты, независимо от того, на каком оборудовании они было получены (поддерживаются даже древние и недокументированные версии ABIF), а также корректировать…

❤1

Signed Father Nurgle

20 Mar 2026, 07:00 UTC≈1,300 views1 reactionsread 8 August 2026

Photo

А вот и релиз новой ветки FragalyseQt. FragalyseQt 0.5 Southern, названной в честь Эдвина Саузерна, чьи работы изменили молекулярную генетику, повлияв в том числе и на эту программу. Эта программа предназначена для анализа данных капиллярного электрофореза, поддерживая до восьми каналов флуоресценции. В новом релизе были добавлены такие возможности, как: 1. Биннинг 2. Импорт панелей GeneMapper, GeneMarker и NCBI O…

👍1

Signed Father Nurgle

18 Mar 2026, 15:51 UTC192 views5 reactionsread 8 August 2026

Photo

Работа над биннингом и экспортом в CODIS продолжается. Для чистых в плане ДНК и полученных на ЧИСТЫХ и СВЕЖИХ капиллярах образцов с чистыми и свежими реагентами (например, положительного контроля, как на скриншоте), выхлоп генотипирования даже совпадает между FragalyseQt и GeneMapper ID-X 1.7 (Спасибо Термо!). За исключением статтеров, конечно. Положительный контроль, ясное дело, не анеуплоидный - это было бы ОЧЕНЬ с…

❤3👍2

Signed Father Nurgle

11 Mar 2026, 19:27 UTCviews —

Posted without readable text

11 Mar 2026, 12:42 UTC≈1,310 views8 reactionsread 8 August 2026

Тем временем, подготовлен новый релиз FragalyseQt - 0.4.3. В этом релизе реализовано одновременное открытие множества файлов (каждый в своей вкладке и может быть проанализирован независимо), также реализована крайне экспериментальная поддержка файлов FRF, получаемых с капиллярника Нанофор-05 производства "Синтол" (пока их можно только просматриватть, работа над возможностью сайзколлинга ещё ведётся, но даже это мож…

👍8

Signed Father Nurgle

19 Feb 2026, 12:33 UTC239 viewsread 8 August 2026

File

File, posted without a caption

Signed Father Nurgle

19 Feb 2026, 12:33 UTC243 views0 reactionsread 8 August 2026

Photo

Провёл лекцию по получению синтетической ДНК. Синтез фрагмента гена RecA (около 50 п.о., маркер NEB 1 kb слева, полимераза Phusion Plus) фага Thermus spp. YS40 получился тоже замечательно! Последовательности олигов для синтеза прилагаю: YS40_RecA_F ATGAACAACGAAAAGATCAA YS40_RecA_R1 CTAATGATCTGCTTGATCTTTTCGTTGTTC YS40_RecA_R2 TTCGCGTAGCTGCTAATGATCTGCTTGATC YS40_RecA_R3 TTAGAGAATTTCTTCGCGTAGCTGCTAATG #dna #днк

Signed Father Nurgle

7 Feb 2026, 22:09 UTC297 views11 reactionsread 8 August 2026

Photo

Спустя около года перерыва, Папа Нургл выпускает новую версию FragalyseQt. В новой версии: -структура соответствует PEP517, можно установить с помощью pip и запускать введя fragalyseqt -доступен сайзинг по локальному и глобальному методам Саузерна -гибкий интерфейс -привязка кнопок "Открыть файл", "О программе", "Экспорт Данных Внутреннего Анализа" и "Экспорт в CSV" к комбинациям клавиш Ctrl+O, F1, Ctrl+I, Ctrl+E …

🔥8❤2👍1

Signed Father Nurgle

Showing the 12 most recent of 17 posts we hold for @nurglescauldron. View and reaction counts are the latest single reading for each post, not a live figure, and a recent post is still accumulating both. A view count marked ≈ was rounded by Telegram before we ever saw it — t.me prints views in full below 1,000 and to three significant figures above, so ≈1,200,000 means somewhere between 1,150,000 and 1,249,999. Unmarked counts are exact. Text is reproduced from the public post preview and truncated for length.

Mentions

Named by 1 registered channel — every channel on the register whose own posts have named this one, by its current username or any other username it currently holds, merged from two separately captured readings of the same fact so a namer caught by only one of them is not missed and a namer both caught is not counted twice. A username this channel has since dropped is not matched — that handle may belong to someone else now, and crediting today’s namer to yesterday’s owner would misattribute it.

Named by

Channels on the register whose posts name this channel's handle.

WebHostMost | The Web Hosting Community
@webhostmost · 4581 post

Names

Channels on the register whose handles appear in this channel's posts.

WebHostMost | The Web Hosting Community
@webhostmost · 4586 posts

A mention is a weaker signal than a forward and is counted separately for that reason — naming a channel is not republishing it, and a handle in a post body is easy to place deliberately. The post counts beside each row below are distinct posts in which the handle appeared, from posts we have read on both sides — the “Named by N registered channels” figure above is a different count, of distinct NAMING CHANNELS rather than posts, and is not the sum of the rows under it.

Cite this entry

A live page changes as we take new readings, so a citation should name the measurement it is based on, not just the URL. The line below cites the subscriber count as measured 8 September 2026 — this entry's latest reading, not the date you are reading this.

“Nurgle's Cauldron” (@nurglescauldron), 146 subscribers as measured 8 September 2026. Telegram Register, tgregister.com/channel/nurglescauldron.

Full measurement history, CC BY 4.0. Every reading this register holds for this entry, not just the latest one, as a dated, downloadable record: CSV · JSON. Free to use with attribution to tgregister.com. Each file carries its own generation timestamp, which is the figure to cite for exactly when the data was retrieved.